Nhận dạng nhanh COVID-19 với mồi và đầu dò của Genewiz

👉👉👉GENEWIZ cam kết thúc đẩy nghiên cứu xung quanh ổ dịch với các giải pháp độc đáo. Mồi và đầu dò được phê duyệt bởi Trung tâm Kiểm soát và Phòng ngừa dịch bệnh (CDC), Tổ chức Y tế Thế giới (WHO) và chính phủ Trung Quốc để xác định nhanh chóng virus.

Oligo_Flex_Corona_LP_US_March2_2020_option2-1

Chất lượng cao – Hệ thống kiểm soát chất lượng nghiêm ngặt với tỷ lệ lỗi thấp
QC khối phổ nâng cao có sẵn để điều chỉnh oligo
Tổng hợp oligo được điều chỉnh ở quy mô thấp tới 25nmol (để giảm thiểu chi phí) hoặc lên tới 1000nmol
Định dạng phân phối ống hoặc tấm có sẵn
Nhiều phương pháp thanh lọc có sẵn
Oligos được sấy khô để giao hàng, để tối đa hóa sự ổn định

Origin Primer ID Description Sequence (5′ – 3′) 5′ Modification 3′ Modification
US CDC 2019-nCoV_N1-F 2019-nCoV_N1 Forward Primer GACCCCAAAATCAGCGAAAT
2019-nCoV_N1-R 2019-nCoV_N1 Reverse Primer TCTGGTTACTGCCAGTTGAATCTG
2019-nCoV_N1-P 2019-nCoV_N1 Probe ACCCCGCATTACGTTTGGTGGACC 5′-FAM 3′-BHQ1
2019-nCoV_N2-F 2019-nCoV_N2 Forward Primer TTACAAACATTGGCCGCAAA
2019-nCoV_N2-R 2019-nCoV_N2 Reverse Primer GCGCGACATTCCGAAGAA
2019-nCoV_N2-P 2019-nCoV_N2 Probe ACAATTTGCCCCCAGCGCTTCAG 5′-FAM 3′-BHQ1
2019-nCoV_N3-F 2019-nCoV_N3 Forward Primer GGGAGCCTTGAATACACCAAAA
2019-nCoV_N3-R 2019-nCoV_N3 Reverse Primer TGTAGCACGATTGCAGCATTG
2019-nCoV_N3-P 2019-nCoV_N3 Probe AYCACATTGGCACCCGCAATCCTG 5′-FAM 3′-BHQ1
RP-F RNAse P Forward Primer AGATTTGGACCTGCGAGCG
RP-R RNAse P Reverse Primer GAGCGGCTGTCTCCACAAGT
RP-P RNAse P Probe TTCTGACCTGAAGGCTCTGCGCG 5′-FAM 3′-BHQ1
WHO RdRP_SARSr-F2 RdRP gene GTGARATGGTCATGTGTGGCGG
RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA
RdRP_SARSr-P2 CAGGTGGAACCTCATCAGGAGATGC 5′-FAM 3′-BHQ1
Primer RdRP_SARSr-F2 GTGARATGGTCATGTGTGGCGG
Primer RdRP_SARSr-R1 CARATGTTAAASACACTATTAGCATA
Probe RdRP_SARSr-P1 CCAGGTGGWACRTCATCMGGTGATGC 5′-FAM 3′-BHQ1
E_Sarbeco_F1 E gene ACAGGTACGTTAATAGTTAATAGCGT
E_Sarbeco_R2 ATATTGCAGCAGTACGCACACA
E_Sarbeco_P1 ACACTAGCCATCCTTACTGCGCTTCG 5′-FAM 3′-BHQ1
Chinese CDC 2019-nCoV-OFP CCCTGTGGGTTTTACACTTAA
2019-nCoV-ORP ORF1ab ACGATTGTGCATCAGCTGA
2019-nCoV-OP CCGTCTGCGGTATGTGGAAAGGTTATGG 5′-FAM 3′-BHQ1
2019-nCoV-NFP GGGGAACTTCTCCTGCTAGAAT
2019-nCoV-NRP Nucleoprotein-protein N CAGACATTTTGCTCTCAAGCTG
2019-nCoV-NP TTGCTGCTGCTTGACAGATT 5′-FAM 3′-BHQ1
*W is A/T; R is G/A; M is A/C ; FAM, 6-carboxyfluorescein; BHQ1, blackhole quencher.

_______________________________________________
👉Nguồn: https://web.genewiz.com/us_coronavirus-lp

👉👉Tham khảo:
1. US Centers for Disease Control and Prevention. (2020, February 4). Real-time RT-PCR panel for detection 2019-novel coronavirus. https://www.cdc.gov/…/rt-pcr-panel-for-detection-instructio….
2. Author Unknown. (2020, January 17). Diagnostic detection of 2019-nCoV by real-time RT-PCR. https://www.who.int/…/defau…/coronaviruse/protocol-v2-1.pdf….
3. National Institute For Viral Disease Control and Prevention. (2020, January 21). Specific primers and probes for detection 2019 novel coronavirus. http://ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html.

#ABT_Việt_Nam

Đối tác - Khách hàng

Copyright 2018 © ABT | Thiết kế bởi Web Bách Thắng